H5322 030 02

2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) - H5322-030- in GA Star Rating Details

Number of Members enrolled in this plan in (H5322 - 030): 47,735 members : Plan’s Summary Star Rating: 4 out of 5 Stars. • Customer Service Rating: 4 out of 5 Stars. • Member Experience Rating: 5 out of 5 Stars. • Drug Cost Accuracy Rating: 3 out of 5 Stars. — Plan Premium Details — The Monthly Premium is Split as Follows: : Total ...UnitedHealthcare offers UHC Dual Complete GA-D002 (HMO-POS D-SNP) plans for Georgia and eligible counties. This plan gives you a choice of doctors and hospitals. Learn about lookup tools.2024. H4537-002. Wellcare All Dual Assure (HMO D-SNP) 2024. H9900-009. Wellcare No Premium Value (HMO-POS) 2024. H1416-082. Discover Medicare insurance plans accepted by John Schumann, MD and find primary care doctors accepting Medicare near you.H5322-031-000 Look inside to take advantage of the health services and drug coverages the plan provides. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m. - 8 p.m. local time, 7 days a week www.UHCCommunityPlan.com Y0066_SB_H5322_031_000_2022_M2019 UnitedHealthcare Dual Complete (HMO-POS SNP) - H5322-030- in GA Plan Benefits DetailsPlan ID: H5322-042. Have Medicare questions? Talk to a licensed agent today to find a plan that fits your needs. Get Medicare Help $ 39.00. Monthly Premium. AARP Medicare Advantage from UHC GA-0006 (HMO-POS) is a HMO-POS Medicare Advantage (Medicare Part C) plan offered by UnitedHealthcareANSI: 5322 232-02. remove add. shopping_cart Add to cart . Product data. Weight of item (WT) 0.0044 kg. Release date (ValFrom20) 3/1/99 . Release pack id (RELEASEPACK) 99.1 . Join us. Stay updated. Sign up for our newsletter today. Email * Sign up . Careers Contact us About Sandvik Coromant For press Safety information .

AzHDR.org – Home of the Registry. The Arizona Healthcare Directives Registry (AzHDR) now resides with the Arizona health information exchange (HIE). In 2019, legislation authorized the transition of the registry from the Secretary of State’s office to the HIE to improve healthcare provider access to advance directives.0922 768 8431. (Mga Pananaw: 3, Mga Komento: 0, Rating: Neutral) 0998 564 4882. (Mga Pananaw: 3, Mga Komento: 0, Rating: Neutral) 0935 730 6814. (Mga Pananaw: 5, Mga Komento: 0, Rating: Neutral) Nakatanggap ka ba ng isang tawag mula sa numero 0253229910 / (02) 5322 9910 mula sa Pilipinas at hindi alam kung sino ito? Tingnan ang …Jan 1, 2024 · Summary of Benefits 2024. UHC Dual Complete OK-V001 (HMO-POS D-SNP) H5322-033-000 Look inside to learn more about the plan and the health and drug services it covers. Call Customer Service or go online for more information about the plan. Toll-free1-844-560-4944, TTY711. 8 a.m.-8 p.m. local time, 7 days a week. UHCCommunityPlan.com. H5322-030-000 Look inside to take advantage of the health services and drug coverages the plan provides. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m.-8 p.m. local time, 7 days a week UHCCommunityPlan.com Y0066_SB_H5322_030_000_2023_M... 02d et Berwyn. Cora sten ri869 Winthrop av ... h5322 S Ashland av. Fshngraph Co 17831 Crandon ... h030 N Fairfield. "Emil gro 1334 Crittenden. Duncan cond r1829 N ...To join Aetna Medicare Premier Plan (HMO), you must: Be entitled to Medicare Part A. Be enrolled in Medicare Part B. Live in the plan's service area. Service area: Georgia: Chatham, Columbia, Effingham, Glynn. Plan type: Aetna Medicare Premier Plan (HMO) is an HMO plan. This is a Medicare Advantage plan that covers prescription drugs.ANSI: 5322 120-02. remove add. shopping_cart Add to cart . Product data. Weight of item (WT) 0.0036 kg. Release date (ValFrom20) 4/8/08 . Release pack id (RELEASEPACK) 08.1 . Join us. Stay updated. Sign up for our newsletter today. Email * Sign up . Careers Contact us About Sandvik Coromant For press Safety information .

2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) - H5322-030- in GA Star Rating DetailsY0066_INTRO_2024_M UHEX24HM0154138_000 UCard opens doors where it matters Once you re a member, you ll receive your new UnitedHealthcare UCard in the mail.Please leave a comment to help others. Leave a Comment. The phone number 63253222399 is located in or around Philippines. The phone number +63 2 5322 2399 has been searched 73 times. The last time users looked for a phone number was 24.04.2024 13:13. The phone number has been reported as spammed 0 times.H5322-040-000 Look inside to learn more about the plan and the health and drug services it covers. Call Customer Service or go online for more information about the plan. Toll-free 1-844-723-6473, TTY 711 8 a.m.-8 p.m. local time, 7 days a week AARPMedicarePlans.com Y0066_SB_H5322_040_000_2024_M. AARPMedicarePlans.comGeorgia. Health Plans. Georgia 2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) UHC Dual Complete GA-D002 (HMO-POS D-SNP) CMS Rating. Medicare. What is a …

Middlesex township splash pad.

Y0066_EOC_H5322_030_000_2023_C. OMB Approval 0938-1051 (Expires: February 29, 2024) January 1 - December 31, 2023 Evidence of Coverage Your Medicare Health Benefits and Services and Prescription Drug Coverage as a Member of our plan This document gives you the details about your Medicare health care and prescription drugUnitedHealthcare Dual Complete (HMO D-SNP) is a Medicare Advantage (Part C) Special Needs Plan by UnitedHealthcare. Premium: $25.1. Enroll Now. This page features plan details for 2022 UnitedHealthcare Dual Complete (HMO D-SNP) H5322 - 025 - 0 available in Select Counties in Texas. IMPORTANT: This page features the 2022 version of this plan.H5322-030-000 Look inside to learn more about the plan and the health and drug services it covers. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m.-8 p.m. local time, 7 days a week UHCCommunityPlan.com Y0066_SB_H5322_030_000_2024_M.Get 2018 Medicare Advantage Part C/Part D Health and Prescription plan benefit details for any plan in any state, including premiums, deductibles, Rx cost-sharing and health benefits/cost-sharing. Sign-up for our free Medicare Part D Newsletter, Use the Online Calculators, FAQs or contact us through our Helpdesk -- Powered by Q1Group LLC2020 UnitedHealthcare Dual Complete (HMO-POS D-SNP) - H5322-030- in GA Star Rating Details... 02 I Union Fidelity Title Insurance Company's ... 030-31-32 1054 (1926) R. L. POLK, & CO.'S ... h5322 Beeler Drayton (Sterrett & Acheson) ra Sewickley&n...

UnitedHealthcare Dual Complete (HMO D-SNP) (H5322-028) UnitedHealthcare Dual Complete Select (HMO D-SNP) (H5322-034) UnitedHealthcare Dual Complete Choice (Preferred Provider Organization (PPO) D-SNP) (H0271-055) 2023 plan changes In 2023, there are 3 new D-SNP plans: • H5253-122 and H5322-034 are select HMO D-SNP plansView and download important forms and documents about your BlueMedicare plan from Florida Blue. Call Member Services at 1-800-926-6565 (TTY 1-800-955-8770 ) Hours: 8:00 a.m. to 8:00 p.m. local time, seven days a week, from October 1 through March 31, except for Thanksgiving and Christmas. From April 1 through September 30, our hours are 8:00 a ...HMO D-SNP H5322-030 refers to a specific type of Medicare Advantage plan. Let's break down what each part of this term means: In summary, HMO D-SNP H5322-030 is a type of Medicare Advantage plan offered by an insurance company. It's designed for individuals who are eligible for both Medicare and Medicaid and follows the structure […]H5322-025 -000. Monthly premium: $ 0.00 *. *Your costs may be as low as $0, depending on your level of Extra Help. Our plan is a Medicare Advantage HMO Plan (HMO stands …Plan ID: H5322-031. Have Medicare questions? Talk to a licensed agent today to find a plan that fits your needs. Get Medicare Help $ 0.00. Monthly Premium. UHC Dual Complete OK-S002 (HMO-POS D-SNP) is a HMO-POS Medicare Advantage (Medicare Part C) plan offered by UnitedHealthcareY0066_INTRO_2024_M UHEX24HM0154138_000 UCard opens doors where it matters Once you re a member, you ll receive your new UnitedHealthcare UCard in the mail.Summary of Benefits 2024. UHC Dual Complete OK-V001 (HMO-POS D-SNP) H5322-033-000 Look inside to learn more about the plan and the health and drug services it covers. Call Customer Service or go online for more information about the plan. Toll-free1-844-560-4944, TTY711. 8 a.m.-8 p.m. local time, 7 days a week. UHCCommunityPlan.com.UnitedHealthcare Dual Complete (HMO D-SNP) is a Medicare Advantage (Part C) Special Needs Plan by UnitedHealthcare. Premium: $25.1. Enroll Now. This page features plan details for 2022 UnitedHealthcare Dual Complete (HMO D-SNP) H5322 - 025 - 0 available in Select Counties in Texas. IMPORTANT: This page features the 2022 version of this plan.5322 420-02. Insert shim. bookmark Save to list. Generic representation. Available. ISO: 5322 420-02. Material Id: 5762675. Package quantity: 10. EAN: 10045276. ANSI: 5322 420-02. remove add. shopping_cart Add to cart . Product data. Weight of item (WT) 0.0094 lb. Release date (ValFrom20) 01/03/1999 . Release pack id (RELEASEPACK) Learn More about UnitedHealthcare UHC Dual Complete GA-D002 (HMO-POS D-SNP) Plan Details, including how much you can expect to pay for coinsurance, deductibles, premiums and copays for various services covered by the plan.

H5322-025-000 Look inside to take advantage of the health services and drug coverages the plan provides. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m.-8 p.m. local time, 7 days a week UHCCommunityPlan.com Y0066_SB_H5322_025_000_2023_M

4 out of 5 stars* for plan year 2024. UHC Dual Complete OK-V001 (HMO-POS D-SNP) is a HMO-POS D-SNP Medicare Advantage (Medicare Part C) plan offered by UnitedHealthcare. Plan ID: H5322-033-000. * Every year, the Centers for Medicare & Medicaid Services (CMS) evaluates plans based on a 5-star rating system. $0.00 Monthly Premium. H5322-030-000 Look inside to take advantage of the health services and drug coverages the plan provides. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m. - 8 p.m. local time, 7 days a week www.UHCCommunityPlan.com Y0066_SB_H5322_030_000_2022_M The following Medicare Advantage plan benefits apply to the UnitedHealthcare Dual Complete (HMO-POS D-SNP) (H5322 - 030) in Evans, Georgia . This plan is …Jan 21, 2015 ... 030 905 430 P. -. -. Arosa. 1000 ALD-ANV. 37. 05.97-06.04. 4. E4448. F4448. -. -. -. Arosa. 1000 ALL. 37. 05.97-06.04. 4. E4004. F4004.2019 UnitedHealthcare Dual Complete (HMO-POS SNP) - H5322-030- in GA Plan Benefits DetailsOn-site Safety Staffing. HB NEXT can provide your company with fully-trained safety professionals who have you covered for any project, no matter the size or duration. Our safety consultants have provided staffing services across a wide variety of industries. Don't waste your time recruiting and hiring - let us help!4 out of 5 stars* for plan year 2024. AARP Medicare Advantage from UHC GA-0005 (HMO-POS) is a HMO-POS Medicare Advantage (Medicare Part C) plan offered by UnitedHealthcare. Plan ID: H5322-041-000. * Every year, the Centers for Medicare & Medicaid Services (CMS) evaluates plans based on a 5-star rating system. $0.00 …

Intranet atrium health.

Elizabeth vargas 1993.

2022 UnitedHealthcare Dual Complete (HMO-POS D-SNP) - H5322-030- in GA Plan Benefits DetailsMiami Miami OnlyFans model covered in bruises after stabbing beau to death: photos Miami prosecutors say Clenney, 26, was the abuser in their volatile relationship that culminated in his April 3 deathANSI: 5322 232-02. remove add. shopping_cart Add to cart . Product data. Weight of item (WT) 0.0097 lb. Release date (ValFrom20) 3/1/99 . Release pack id (RELEASEPACK) 99.1 . Join us. Stay updated. Sign up for our newsletter today. Email * Sign up . Careers Contact us About Sandvik Coromant For press Safety information .H5322-025-000 Look inside to take advantage of the health services and drug coverages the plan provides. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m.-8 p.m. local time, 7 days a week UHCCommunityPlan.com Y0066_SB_H5322_025_000_2023_MUnitedHealthcare offers UnitedHealthcare Dual Complete® (HMO-POS D-SNP) H5322-030-000 plans for Georgia and eligible counties. This plan gives you a choice of doctors and hospitals. Learn about steps to enroll.Paper Enrollment Application Submission Effective immediately, use the following instructions to submit paper enrollment applications for all MA and PDP plans in the UnitedHealthcare® Medicare Solutions portfolio, excluding UnitedHealthcare Senior Care Options (SCO) and People's Health plans. Paper Enrollment Application SubmissionFactory Pack Quantity: 50. Subcategory: Power Connectors. Part # Aliases: 073-00-000-5322 073 00 000 5322. Unit Weight: 0.880015 oz. Select at least one checkbox above to show similar products in this category.2020 UnitedHealthcare Dual Complete (HMO-POS D-SNP) - H5322-030- in GA Star Rating Details... 02 Park nr e and w HOLLAND — Fm 1500 54th HV. 1 n ... rl030 Mandana blvd " Myrna tchr rl030 Mandana blvd ARMES. ... h5322 Locksley av " Geo G lab r2320 Haste B "...ANSI: 5322 230-02. remove add. shopping_cart Add to cart . Product data. Weight of item (WT) 0.0018 kg. Release date (ValFrom20) 3/1/99 . Release pack id ... ….

UnitedHealthcare Dual Complete (HMO D-SNP) is a Medicare Advantage (Part C) Special Needs Plan by UnitedHealthcare. Premium: $25.1. Enroll Now. This page features plan details for 2022 UnitedHealthcare Dual Complete (HMO D-SNP) H5322 - 025 - 0 available in Select Counties in Texas. IMPORTANT: This page features the 2022 version of this plan.H1278-016-AARP Medicare Advantage Choice (PPO) H5322-026-UnitedHealthcare Dual Complete Plan 2 (HMO D -SNP) 025C-UnitedHealthcare Dual Complete (HMO D -SNP) 029-Humana Gold Plus (HMO) San Antonio 036C-Humana Gold Plus (HMO D-SNP) H4590 - 010 - AARP Medicare Advantage SecureHorizons (HMO) ... H4590-803-Group Retiree Plan(s) H0028- 030-Humana ...H5322-031-000 Look inside to take advantage of the health services and drug coverages the plan provides. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m. - 8 p.m. local time, 7 days a week www.UHCCommunityPlan.com Y0066_SB_H5322_031_000_2022_MNumber of Members enrolled in this plan in (H5322 - 025): 25,188 members : Plan's Summary Star Rating: 3.5 out of 5 Stars. • Customer Service Rating: Insufficient data to rate this plan. • Member Experience Rating: 4 out of 5 Stars. • Drug Cost Accuracy Rating: 4 out of 5 Stars. — Plan Premium Details — The Monthly Premium is Split ... Oklahoma UnitedHealthcare Dual Complete® Special Needs Plans. UHC Dual Complete Special Needs Plans (SNP) offer benefits for people with both Medicare and Medicaid. These SNP plans provide benefits beyond Original Medicare, such as transportation to medical appointments and routine vision exams. Members must have Medicaid to enroll. ... 02 Park nr e and w HOLLAND — Fm 1500 54th HV. 1 n ... rl030 Mandana blvd " Myrna tchr rl030 Mandana blvd ARMES. ... h5322 Locksley av " Geo G lab r2320 Haste B "...Summary of Benefits 2023 UnitedHealthcare Dual Complete® (HMO-POS D-SNP) H5253-041-000 Look inside to take advantage of the health services and drug coverages the plan provides.2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) - H5322-030- in GA Star Rating DetailsBuy Jaeger Circular Connector, 6 Contacts, Cable Mount, Male 5322 060 06. Browse our latest Industrial Circular Connectors offers. Free Next Day Delivery available. H5322 030 02, 2021 UnitedHealthcare Dual Complete (HMO-POS D-SNP) - H5322-030- in GA Plan Benefits Details, ANSI: 5322 420-02. remove add. shopping_cart Add to cart . Product data. Weight of item (WT) 0.0043 kg. Release date (ValFrom20) 3/1/99 . Release pack id (RELEASEPACK) 99.1 . Join us. Stay updated. Sign up for our newsletter today. Email * Sign up . Careers Contact us About Sandvik Coromant For press Safety information ., 5322 110-02. Product Details. Catalog Page N/A. Brand SANDVIK COROMANT. For Use With Mfr. Model Number C4-SRDCN-00050-12A. UNSPSC 31163301. Country of Origin Sweden (subject to change) Product Details Feedback. Web Price. $11.95 / each. Qty. Only digits can be entered. Maximum value: 99999. Add to Cart., ANSI: 5322 270-02. remove add. shopping_cart Add to cart . Product data. Weight of item (WT) 0.003 kg. Release date (ValFrom20) 3/1/99 . Release pack id (RELEASEPACK) 99.1 . Join us. Stay updated. Sign up for our newsletter today. Email * Sign up . Careers Contact us About Sandvik Coromant For press Safety information ., H5322-034-000 Look inside to learn more about the plan and the health and drug services it covers. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m.-8 p.m. local time, 7 days a week UHCCommunityPlan.com Y0066_SB_H5322_034_000_2024_M, RNA-binding protein that interacts with purine-rich sequences and is involved in nuclear mRNA export; probably mediated by association with the TREX complex. Mitotic Index. 0.0218. Interphase Cluster: #76 (27 genes) Mitotic Cluster: #52 (29 genes) sgRNA 1: GCAGCATTAATTACAACTGG (interphase cells: 3439, mitotic cells: 70), 2020 UnitedHealthcare Dual Complete (HMO-POS D-SNP) - H5322-030- in GA Plan Benefits Details, 2020 UnitedHealthcare Dual Complete (HMO-POS D-SNP) - H5322-030- in GA Star Rating Details, H5322-030-000 Look inside to learn more about the plan and the health and drug services it covers. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m.-8 p.m. local time, 7 days a week UHCCommunityPlan.com Y0066_SB_H5322_030_000_2024_M., Ohio UnitedHealthcare Dual Complete® Special Needs Plans. UHC Dual Complete Special Needs Plans (SNP) offer benefits for people with both Medicare and Medicaid. These SNP plans provide benefits beyond Original Medicare, such as transportation to medical appointments and routine vision exams. Members must have Medicaid to enroll., Premium: $35.90. Enroll Now. This page features plan details for 2023 UnitedHealthcare Dual Complete (HMO-POS D-SNP) H5322 - 030 - 0 available in Select Counties in Georgia. IMPORTANT: This page features the 2023 version of this plan. See the 2024 version using the link below: 2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) H5322 - 030 - 0., ... hl030 Franklin av. Cryderman Carl W (Velma P) ... hl02 Ocean way (S. S). —Daniel (Ethel) aud Police Judge h PO box ... h5322 Ash. Eagles Club John D Gabol mgr 894 ..., You need to enable JavaScript to run this app., 2024 Medicare Advantage Plan Benefits explained in plain text. Plain text explanation available for any plan in any state. Sign-up for our free Medicare Part D Newsletter, Use the Online Calculators, FAQs or contact us through our Helpdesk -- Powered by Q1GROUP LLC and National Insurance Markets, Inc, UHC Dual Complete OK-S002 (HMO-POS D-SNP) covers additional benefits and services, some of which may not be covered by Original Medicare (Medicare Part A and Part B). Coverage. Cost. Chiropractic Services. In-Network: Copayment for Medicare-covered Chiropractic Services $0.00. Copayment for Routine Care $0.00. Maximum 12 Routine …, Premium: $35.90. Enroll Now. This page features plan details for 2023 UnitedHealthcare Dual Complete (HMO-POS D-SNP) H5322 – 030 – 0 available in Select Counties in Georgia. IMPORTANT: This page features the 2023 version of this plan. See the 2024 version using the link below: 2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) …, Find out the benefits, features and resources of the H5322-030-000 plan, one of the four plans offered by Georgia UnitedHealthcare Dual Complete® Special Needs Plans (SNP) …, H5322-025-000 Look inside to take advantage of the health services and drug coverages the plan provides. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m.-8 p.m. local time, 7 days a week UHCCommunityPlan.com Y0066_SB_H5322_025_000_2023_M, The UnitedHealthcare Dual Complete (HMO-POS D-SNP) (H5322 - 030) currently has 11,173 members. There are 49 members enrolled in this plan in Evans, Georgia, and 11,095 members in Georgia. The Centers for Medicare and Medicaid Services (CMS) has given this plan carrier a summary rating of 4.5 stars. The detail CMS plan carrier ratings are as ... , Summary of Benefits 1 2023-H5325.002.1 H5325-002 Aetna Medicare Assure (HMO D‑SNP) H5325 ‑ 002 Here's a summary of the services we cover from January 1, 2023 through December 31, 2023., Phone:1-877-757-4440. Fax: 1-877-757-8885 Phone:1-877-490-8982. ONLY send Medical Records associated with an inpatient admission to. https://eprg.wellmed.net. Or Fax: 1-844-567-6855. Referrals to specialists are required in some markets. All referral requests must be submitted through the provider portal (ePRG):, H5322-033-000 Look inside to take advantage of the health services and drug coverages the plan provides. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m.-8 p.m. local time, 7 days a week UHCCommunityPlan.com Y0066_SB_H5322_033_000_2023_M, 2024 Medicare Advantage Plan Benefits explained in plain text. Plain text explanation available for any plan in any state. Sign-up for our free Medicare Part D Newsletter, Use the Online Calculators, FAQs or contact us through our Helpdesk -- Powered by Q1GROUP LLC and National Insurance Markets, Inc, Number of Members enrolled in this plan in (H5322 - 025): 25,188 members : Plan’s Summary Star Rating: 3.5 out of 5 Stars. • Customer Service Rating: Insufficient data to rate this plan. • Member Experience Rating: 4 out of 5 Stars. • Drug Cost Accuracy Rating: 4 out of 5 Stars. — Plan Premium Details — The Monthly Premium is Split ..., Inpatient hospital coverage. • In-network: In 2020 the amounts for each benefit period are $0 or: $1,408 deductible for days 1 through 60. $352 copay per day for days 61 through 90. $0 per day for days 91 and beyond (authorization required) • Out-of-network: Not Applicable (authorization required), UnitedHealthcare Dual Complete® (HMO-POS D-SNP) dummy spacing Benefits In-Network Inpatient Hospital Care2 $0 copay - $1,556 copay per stay Our plan covers an unlimited number of days for an, Emergency care/Urgent care. • Emergency: $0 or $90 copay per visit (always covered) • Urgent care: $0 or $65 copay per visit (always covered) Inpatient hospital coverage. • In 2020 the amounts for each benefit period are $0 or: $1,408 deductible for days 1 through 60. $352 copay per day for days 61 through 90., Learn More about UnitedHealthcare UHC Dual Complete GA-D002 (HMO-POS D-SNP) Plan Details, including how much you can expect to pay for coinsurance, deductibles, premiums and copays for various services covered by the plan., 4 out of 5 stars* for plan year 2024. UHC Dual Complete TX-D007 (HMO-POS D-SNP) is a HMO-POS D-SNP Medicare Advantage (Medicare Part C) plan offered by UnitedHealthcare. Plan ID: H5322-025-000. * Every year, the Centers for Medicare & Medicaid Services (CMS) evaluates plans based on a 5-star rating system. $0.00 Monthly Premium., Plan ID: H5322-040. Have Medicare questions? Talk to a licensed agent today to find a plan that fits your needs. Get Medicare Help $ 0.00. Monthly Premium. AARP Medicare Advantage from UHC SC-0005 (HMO-POS) is a HMO-POS Medicare Advantage (Medicare Part C) plan offered by UnitedHealthcare, Y0066_EOC_H5322_028_000_2023_C. OMB Approval 0938-1051 (Expires: February 29, 2024) January 1 – December 31, 2023 Evidence of Coverage , 2023 UnitedHealthcare Dual Complete (HMO-POS D-SNP) - H5322-030- in GA Plan Benefits Explained, H5322-030-000 Look inside to take advantage of the health services and drug coverages the plan provides. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m.-8 p.m. local time, 7 days a week UHCCommunityPlan.com Y0066_SB_H5322_030_000_2023_M